1. Intensity files for four Samples

            Leaf, Root, Panicle, Suspension Cells

 

2. Download genes from the rice genome

      http://rice.tigr.org/tdb/e2k1/osa1/data_download.shtml

 

            From chromosome 10, download the Transcript Sequences (.cDNA) between 10 M and 11M bases.

 

3. Map probes to genes           

           

      Assume that you work under windows, then down load blatSuite33X5.zip from http://hgwdev.cse.ucsc.edu/~kent/exe/windows/

      Here is an example on how to use Blat.

(1) Download DNA files and probe files (example.rar)

(2) Execute command ¡°blat.exe -minMatch=1 DNA1.fa prob_dna2.fa dna_out1.psl¡±. The result dna_out1.psl shows whether (and where) the probe (probe_dna2.fa)occurs in the DNA (DNA1.fa)

(3) Execute command ¡°blat.exe -minMatch=1 DNA_list prob_list dna_out2.psl¡°. The result (dna_out2.psl) shows where the list of probes (prob_list) occur in the list of genes (DNA_list).

 

4. What you need to do is to find out where the probes (from the intensity files) occur in the rice genes (that you downloaded). The result should be in the following format.

 

Probe                                                                           gene

AGCAAAAATCATCAGCCTCTTCGTTACGATCGGTGA            LOC_Os10g19300|12010.t01472|...  

AATAAATTTGAGGTTAAGACTTTACACATACTGTAA            LOC_Os10g19320|12010.t01472|...

 

 

Note 1: Ignore the probes that do not start with a real number in the intensity file.

Note 2: The gene column should contain the full description of the gene.

Note 3: Separate probe and gene column with a tab.

Note 4: Keep the probes in the same order as in the intensity files.

Note 4: The four intensity files use the same set of probes. So you only need to do this for one file.